SMAD4, SMAD family member 4, 4089

N. diseases: 575; N. variants: 144
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs7229678
rs7229678 		1.000 0.040 18 51051412 3 prime UTR variant G/A;C snv 0.37
CUI: C0009324
Disease: Ulcerative Colitis
Ulcerative Colitis 		Digestive System Diseases 0.010 1.000 1 2019 2019
dbSNP: rs11875522
rs11875522 		18 51065392 intron variant G/A snv 1.1E-02 4.8E-02
CUI: C0392885
Disease: High density lipoprotein measurement
High density lipoprotein measurement 		0.700 1.000 1 2012 2012
dbSNP: rs11875522
rs11875522 		18 51065392 intron variant G/A snv 1.1E-02 4.8E-02
CUI: C0428472
Disease: Serum HDL cholesterol measurement
Serum HDL cholesterol measurement 		0.700 1.000 1 2012 2012
dbSNP: rs761937143
rs761937143 		1.000 0.040 18 51047229 synonymous variant A/C snv 8.0E-06
CUI: C0206698
Disease: Cholangiocarcinoma
Cholangiocarcinoma 		Neoplasms 0.010 1.000 1 2019 2019
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0432072
Disease: Dysmorphic features
Dysmorphic features 		0.700 1.000 13 2004 2016
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 2014 2014
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2014 2014
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.710 1.000 3 2014 2019
dbSNP: rs121912577
rs121912577 		0.925 0.160 18 51067115 stop gained C/G;T snv 8.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs121912577
rs121912577 		0.925 0.160 18 51067115 stop gained C/G;T snv 8.0E-06
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 0
dbSNP: rs786204125
rs786204125 		1.000 0.120 18 51076682 frameshift variant -/GCTACTGCACAAGCTGCAGCAGCTGCCC delins 4.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 1999 2015
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C1275122
Disease: Familial multiple trichoepitheliomata
Familial multiple trichoepitheliomata 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms; Skin and Connective Tissue Diseases 0.010 1.000 1 2014 2014
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 7 2011 2016
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.820 1.000 4 2011 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0152427
Disease: Polydactyly
Polydactyly 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.010 1.000 1 2020 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0034013
Disease: Precocious Puberty
Precocious Puberty 		Endocrine System Diseases 0.010 1.000 1 2020 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 0
dbSNP: rs1343555503
rs1343555503 		1.000 0.040 18 51058364 missense variant G/A snv 4.0E-06
CUI: C0003486
Disease: Aortic Aneurysm
Aortic Aneurysm 		Cardiovascular Diseases 0.010 1.000 1 2017 2017
dbSNP: rs80338963
rs80338963 		0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.800 1.000 14 1997 2016
dbSNP: rs80338965
rs80338965 		0.851 0.480 18 51067121 frameshift variant CAGA/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 12 1998 2017
dbSNP: rs587783060
rs587783060 		1.000 0.120 18 51078354 frameshift variant -/A delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 11 2000 2013